Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ571026
Length 655 bp
Fasta Format > rwhok10j02
ctggagtgtcgcggtacacgtacaataaagtctcggttctcctcaaaggt agtgaaagtaaaaacaaccatagtagtagtacaatagttgccggccatgc agagctagctcggcgtacgcactcctttctccctcacatggagatcagat cagagcatttattcatatgtattagagacctcagcatactcagcggtgat ggatggcgctatggacggcagccatggtgggcagtggttgatcagcgaat cttagagcagtcgacgttagcgctgattgcatatgggacgctgacgccgc acttggaggggatgccggcggccttgccagcgttgagcccaccggcagcg ctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgc cccggccagactcctgacaccgctgcagcaggcagcagtcgggttggcgc cattgccgcgggcataggagatgcaggggctcaaggcggaggtcacctga ccgcaggagatggccgcgtcggtggctacgaggagcatagtggccaccat ggcgaccagcacgagcggaatagctgcaccgcgagccatccctatcgagt ttgcagtantaatcgtgttgaactcanctggagatggtgagaggctanat ttgct
Download
page-top