Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570967
Length 836 bp
Fasta Format > rwhok10f22
tttttgtcaaaataacaaacagcaacaagtcatggtactattgagtactt tctctcaaaagctcaaaattaacactgacttcgaaatggtgcaaaggtgc aaaggaagaaaacctaaagaagagtccatgcttaggaacaaaatctggtg cgcggcagacaaattcaagcaactgcaaaaatctcaacctgctggcaggg cacagcgcatgcatttcagggcaggcagcttcagttcttcctccagccgg tcgacgaagaagaagccgatgaagaatttgcagagggcctagatccacca ccaggacgccagcggtcagtagtagaaccagctggaggagcaccatctgg ctggcgggctgggggcgcttcttggcgcgcgggaggaacatcttggcgga ggggacggcggctccagcggtctgcttcctggagcgggagcgcatcctgg cagagggggcgcacttcccgtgcatgaggagcctcttggcgagcatccca acggtctgctgcttcaggtgcaacagccgtcctctggctgctaccctcac cgccacgtctgtgccgcgggacaaacttgttagaaccaggagcggcggct ggtggtgcgatggtggcagtaggccgcgcatcaggtgggtccgctgctct taggagagcctcccttctctctttttccttcttctcttccacctcccttt ccttctccctctgaattgctgcaatggcgtcaagcttgagtttcgtctcc gcttcctccctcttcttcctctcttcctcttcatgttttctagcctcctc ttcctcgcgcaccctttgaatccgttgttcctccat
Download
page-top