Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570966
Length 869 bp
Fasta Format > rwhok10f21
aatctggaagtattttttcgccagctaatttaagaagggattacatgaag gagaaggaccaatgaaaatgctgcagtatagaactgccaatacttctctt catctgataaagtaagaactgcttggattcatgggcatttgttcatcctt ccttgtgtattcagagccttgttctatttcaaaactactggttgatggtg cactgagaaagctctctgtatcagcatcgtgatgcatccaaggatgtttg gaaagcctccttaatctggtaagctccatagatacctctttcatggaggg cctgttgtcaccacacatatccaagcattgctttgctagttccgctagtc cagtaagcagctccatgctctcgtgatcttttatttgactatccaacatg gcatcaaggttgttctccttcatagccactaggaaacatgatgccaagct tctttgtgactcattaccttccagttttagtggcacctgcccagtaagga cttccaaaaggacgacaccaaagctataaacatcgcttttatctgtcaac cgacatgtctgcatatattcaggatccagataaccacaagtcccttgaac cattgtcacaaactgggcttgatcagttggtactagtatggaagccccaa agtcggatacctttgccatgtaattgtcatcaagaaggatgttagaagtt ttcacatcaccatgtagaattggtgggtttgcataggaatgtaaaaatgc aagcccctctgctgcctcatttacgatccttaagagcgaactgaatggga tgtgccgtgtgcggttctttccgtgaagaanatcaaacaatgttcctttt gggatgaactcatacacca
Download
page-top