Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570965
Length 868 bp
Fasta Format > rwhok10f20
gagcagttgcatgcggcccctacgggacatgcggcacacaacggagtgac cggcgaaagacacaaccgatcagccgatacacattattatcattaatagg agctaaagattattgctgatatatgttcagtagcaaacattatcattatt ggcttgcaagctcaagtcagggggggaggaaaacagtagcagctgctcca ccacaaaattactagcatagtacacacataataaacacaggagaaaaaag gagtctcttcatcttcgctgtcttcctccgcaccgagaggagccacatca agatttttcttaggcggacttcacggtggcggcgttgatgatgtcaatga actcaggcttcaaagaagctccaccaacgaggaaaccatcaacgtcgggc tgccctgccaactccttgcagcttgcgccagttacagatcctccatagat gatcctcgtggattcagcaacctcggggctcacattggtcttgagccagt ccctcagattggcatggacttcctgcgcctgagccggtgtcgcaacttta ccggtgccaatggcccacactggttcgtaagcgacaaccacattggtcca gtccttgatcttgccagcaattgcttttgtctgttcagcgacaactgcca tggttgatccagcttctcgctgctcgagagtctcaccaacacatgcaatg accttcaagccctgagcaagtgcatatgcaaccttctctccaacaaactc gcttgattctcccatcaagctcctcctttcagagtgtccaaggatgaccc agggaacgccgaggttgacaagcatctcagcactgacttcaccggtgaaa agcaccgcccttcttcac
Download
page-top