Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570960
Length 869 bp
Fasta Format > rwhok10f05
cgtccctggcacacccaggaagaacaagtgtagatgaacatcacagaggg gattacaattattatgtaaaggggctatcccaggacaacaccccagcaga atgcacacgaaaattacaggacggttaactcagcgaaggaggaccggaag gtttctgggaatgcgactggcgatggcggcgggcgtcgctcaaagatcct cagggccgttgatgtccttgttctcgagcacagctccgtctgggatctcc aacttgactccagccttggcagcgatggtcacgttgcccttgagtacgac tccagagccaaacgagacatcaccagagaccttcaagctgtcgagctcaa cgatgctggggatcgacttgaaacgggcaaggaagttggcaacctttttg aactcaggaccaagctcaattgaagggttcgatggcttcactctggctgg gttgcggatgacgtagccatcaaccaaggtatagagatcagactgcacaa gcaacaaatcagatgtagccttcacgggcagaaaccttgagcggggaacg ttgatgccgattgctttctcaaagaacctgatcgctgctccagctgcggt ttctagctgcaggactttcacgccatcaacttccttagggttgggaatga tttccatcttaagtgcttcagcatctacaagcctcttgatcgccttcaag ttcacccacaggttattggtgttaaatatcttgaacttctcaatcgactt gaattcattcacatgctcatcagggacttgggcaatctccaanagctgga ctcttccttcgtatgagatganggtaccacctttgacatcanccaatgtt tttggagtaacttccatgc
Download
page-top