Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570958
Length 115 bp
Fasta Format > rwhok10f02
agttgctaccttttctacacaacttcgatctccttggaaatcaggcacaa gcgcttcaataagcatatctggctttaaagtcttcagcctctgtactgtt tcagcaaaatggcca
Download
page-top