Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570956
Length 602 bp
Fasta Format > rwhok10e22
cagcaatcacacggtnttgcgaagccacacgcatgcacaaaaccaaaagg catggcagattttacattgaacacgcatgcgcagaagcagcccttgagca gcccaaggacgacgcacatgcacgaaccaaagctagttaattcgctactt ctggaagtagtcctcggtcctgcccttgaacccgatctggccgaaggtga gcgcgatgaacagacccaggtgccacgtcaccaaccacagccagaactgc gactggagagccgggggcgacgggaagtgggcgagctcctcgccgatgct ggagaagaagagccccgtcaagctgttgccgttgatcagcgggatgctcg acggtgccagccacccaatcagcccgaacccgatcacgttcaggtccctc cgcagccagtcccgcgggaacgtcatgcaggtgatcctgccgttcctctc caggttcctcgtcatcagcgggttcctcgccgacacccgggcaccactcg tgaagctggtagagaaggctggccggcgggtgagcgcggcgccggcgagg ccggagacggtggaggtggcggcggccatgtctaagctggtgtgctgcga tg
Download
page-top