Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570952
Length 553 bp
Fasta Format > rwhok10e16
atgctacggaaacatcttgcatgtcaaacatattcagagaacgcatgcct attttcaccatttgcattgataatttaacagagcagacattgacctattg caacaacctactaccgcgcatgcacatcttattacaaagctgacaggacg atcacctaaagaaagaacaaaacagcggacacggcgaccgcgccgagcag accaactccaccggtgacggcgtgacgggaagaggagcttgccggaccag gcgctggggcgggcgcgtgatgatgtggtgacggcgcaggggagtgctga gtgggcgcgtgagccgccgctgcaacttgtgcgctgccaagccgctcggt atggttggggccggatgtcttcgaggacggagagtgcgccggagcgtggt ggtggtgatgatgatnatggcaatggtggtggtggtganccngcnccggt gctgtagcgtggtggccntggtgatgcgggcttggtgccttgtgcagctc gtcgacatccgtgattgtagcagngtccagctcgncggcntncatgtggt gng
Download
page-top