Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570951
Length 508 bp
Fasta Format > rwhok10e14
aatatttggtccagcaacgatacaaagttcccagtttatcaatgtttatg gtccctggattatatcctgaacaagcgcggcaaaccgaaaacaaagcaaa gatagcgctatcaacgctttacagaatttattcttccatctctggacatc tataaacacaaatgtcccccagatgcgtccaagatggggtcaccttcagg caggcgaagatcgctcctagttagttccctcggccttcttgccgtcggcg ccggacttagccttgtcggccgcatccttctcctgttcgagctttttctt gagcttctcctgcctctccctctccatcttctggatgtagacgttctcct tggcgcgctcctcctcgctgagcacgcgccccttcccgtcactcagaagg cgccgcgtcccgctggctaccaccgccggggaccggaggcgcgcggggag cgaggtcagcgcgcatctcatcgccattttggtcgcactctctcgagctc tgcgaatc
Download
page-top