Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570948
Length 866 bp
Fasta Format > rwhok10e08
actcataggnataagatttgatagcagatcatgcaaataagtatatcagg tatcaaacaagatgtccgagaaggccaaaacagaaattcagaaactagca cttgataacaacagaacccactagctgccttaagcatctcatcacttctt ctcctccttctccgcctcggcagccttcttctgcctggctcccaactggc gctggttcatcctctcgacgcggagcttgccataggccttgaactccttc atctcctctgtgaccttcacgacctcaactgagcgcttctcgccgcgggc aatgggcatgtagtcgccctggacctgtgtggcgttggcaagctcctccg gagtagagtcaccagccttgaccttgcgagcacgccttgggaagataaca agcttggccttgtaggtcttaagcctctggatattggactgcataccctc cagcgacctgttcttgcggcgatggtccacagaaatgccaatggtaggag cgagcttctttgggatgccagcggacttaagctcctcaagggtaaagcct ctgccagccctggccttcatgttgtacttgcgggtctggcattgcacaat ggggcgaagaggtccagaggtggggcgagggaagatcttcacagccttct tctggcgagcgatgcggcgcctctgcttgcgggcgggctggttgaaccac gtcttgacatagttctgccagtgcttcttgaagtggccgttggggatgac gttgttgtgcttcaccatctcgccctccttacctgganacnacngtgcng cngcngcggcggcggggaagggctanggttttgccctcntgccnaattcc ctgcancccgggggat
Download
page-top