Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570940
Length 788 bp
Fasta Format > rwhok10d21
tctgacacctgtaacattccagacactaaacaccaccagcgatagtacat agaacctgcctagcagaaccgaagcctaaatcagggaggatgaggcatcc ttttgtacagacccagagcaccaacgcacacctaaaaccacctataagat cagatcagatcagatcaagcggaggcgaccttgcgggccttcttggcggc cggggagcggacggtcttcggcttcgccttggccttcgccgcgggcgact tcttggctttggcgaccagcttcttcttctcgggtgccttgcgcttcgtg ccagcggcggcggccttcttgggcttcgcggaggccttcttcttgggctt ggcggcgtcctttgcgggcttcgccgcagccttgggggcggcgggcttgg ccttgggcttgggggagtccttcttggcggcgtcggagagcttgtaggag gccttgaccttgacgagcttgcccttggcggcggaggagcggagctggac ggagagcatcttcttgaagttggccgggagggccttgccgtgcttctcct cgatgaacttggcgatggcgaccgagctcgacccggtcctgtccttgaga gccgcgatcgcctccttgatcatctcgaagtangtcgggtgggcggctcc ancggcggaggtcttcttcngcttcngcgctgangcgganggcttggcca aagcantcatggtgggctantcnaanaaaatatctgaaanggaaactgct acntgtgcngtgtgctctgctcncttgcngcttcanaa
Download
page-top