Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570936
Length 818 bp
Fasta Format > rwhok10d15
aaaaatatacgtagaaaatactggggtatgcgaggcccatgttttcttgt ataagtcatgtattgtttgttataaatggtgccgtcatcccagcaaataa caagtggcgaccgggttcagatggcagaggatgcccatctctaagagaca actgcatctttcccagccacatcaaaggacagttctcgcttcttgtccga cccaatcttgaaggttggagccacttcctctgcaccagcagagacgctcg ccgaatcgacggagaaaacaagattatccgtagggcttgctgagccaaag ttgaacttggggatatcttggatgtcagctggggggctcctttttggcgg tgagaagaaagtaggtgtgggtggcggttctggaagcgaaactgaggttt tggtgacagggaacgagaacatgaaaccattggtcgcgcttttatccgag actgctgcagctggtgcagttgccacgtcgggttttgaaggatgctgcga gctggtcattgcggcgacttctggggtggccactgggctctggacctttg gagccggctcctcacaattggagctgcttgggggttcctgaaccttcttc acatttgaaatttcctgataancactggcacgctcattgaggctgttctg tctgggagcattattantgatggagtcnggcattttatacnggctgctga tgacaacangggaaatanttctctttgcanttcnccttanctctggcttt actgtangggatggaattgtcctctcaanatgctggantattttctganc tgtctggctcnacttcng
Download
page-top