Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570927
Length 899 bp
Fasta Format > rwhok10d06
tcatagcttcgcacacaggggtggcagggagtcaaagtggcaacaacgcc ccaggaataacacttaacatacactaagattctccaaaaaagacttgaca ctaaaacttctgctagataactcgatggcagacaccagagcactcatttc ttcttgatggcagccttggtaaccttggcaccggtggggtccttcttctc cacgcccttgatgacaccaacagcaaccgtttgtctcatatcacgcacag caaagcggccaagaggagggtaggtggcgaaggtctccacaaccatgggc ttggtgggaatcatcttcacgataccggcgtcaccattcttgaggaactt gggcagcgcctccagctccttaccagatcgcctgtcgatcttggtcacca gctcagcaaacttgacagcaatgtgggaggtgtggcagtccagcactggg gcatagccgttaccgatctgaccagggtggttcatgatgatgacctggga ggtgaagttggccgcctccttggcagggtcatccttggagttggatgcaa caaacccacgcttcagatccttaacagcaacgttcttgacattgaagccg acgttgtcaccaggaagcgcctccagcagagactcgtggtgcatctcaac agacttgacctcagttgtcagaccagtgggaccaaaggtaacaaccatac caggcttgatgacaccagtctcaacacggccaacaggcacagttccaatg ccaccaatcttgtaaacatcctgaaggggaagacgcaggggcttgtctga gggcctcttggggctcgttgatctggtcaagagcctcaagaagggtangg gcccttgtaccantcaaggttggtggacctctcaatcatgttgtcaccc
Download
page-top