Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570926
Length 879 bp
Fasta Format > rwhok10d03
aattgcccagtaacgattcagggcacatactcgaactcaaactcaacccc tatgatagtaaatgttttgagaacgctgccgccaacctacgacaacctct ggagttcgatgcctccaccaaaaacgaatgttgggaaaatccaccctcta cagaaattattgccttccaacgttaaaaagataaaagttcgccagatcct tgaagggcaggactgggaacagacttctcttgttcgtcatcatttcttcc cctctaggcaccgcctgagccgtacttcttgccgaagaagaggatctgga gctgatcgtagccggagagcacaccagcaccagcaatggcacggaggatg ttggcaccagcacccttgaagagagacttggcaccctccttcgccaggat ctgctggaaagcatccaaggagctcttgtacttgacagcctctccggagg tcatcatcatccttctgcggacggtgtcaatggggtaagatgcaagaccg gcaccgttggtgatcaaccaaccaagagcaaagctggcaaagaagttgtc ctggagagtgccagtgaggagaacgggcttcagagaatcatacagtccaa agtacagaccacggtagacaatgattccaacacaagagatgttgaatcca cggtaaagcccagcaataccatctgacttgagagtcttgcggtagacatc aaccaggccattgaattgcctgtcacctccacccttggatgcctttgcgt cattggccagccttgtcctagcatagtccagggagtacacgaagaagagc gaggaagcaccagcagcaccaccagaagcaaggttgccaccgaaccactt ccagtaaccatccttgtccttcttgangt
Download
page-top