Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570921
Length 727 bp
Fasta Format > rwhok10c20
atcacacgttacacatcgcgctacactagagtacagcaaagagttgacag ttcactcacgcatacggacgcatgcatacatgtcgcataaatatatatgc acacacagtgtgtgcgcaaggtacagacatggacacagacacacagtgac acagtactgaaataacacacgcaagcaacttcattttattatttagtagc tcagtatcgtatgagcactccatcaacgtagacattaagctccacacaag cgcgtccttgcatgcacgtcggaagggttatatattgaactagttgacat tgttgcagttggtggacatgctgatggggaagggcacgctgacgccgcac ttgccgggcacgccggagaccttgtccatgttgatggacttgatgctggt ggcgaggctcttgaggcacctgcacgctatcttgcggtccgggctgctgc gggccaggccgttcagcccctgcacaccggagcagcactccttgctgatc gagggcgccttccccgtcacgtacgacacgcacggcgcgagcttggagtc cacctgcccgcacgacagtgccgtcgcctccctgccggccatcattagca ccaccgccgccaggaccacggcggacaccacagccttgctgttgagacga gccatcgatcgctagctggaagttccttaagctgctagctagctagtggg tgatcagatgagtgtcggcggtgtggt
Download
page-top