Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570919
Length 853 bp
Fasta Format > rwhok10c18
cgacttaactcagagactcaccacaagtacacagtgcaatatacggcaaa atgcatgaacttccattgagactcatccaagcctcgaagcagcatgactt aaactcttgcaccatcaagaaacgaaccaaaaacaaaaatactagaacca catctctgctcctattgagttcaactatcgcagataacagacagacgtga cataggttccacataatcaagacactgtcctaaaagcgcattattttaaa tttgatagtctgcgctctccttagaaagcttcacggtcaccaccatagcc accgccacctcggccaccaccgccatagccgccgccgccaccaccatagc cgccgccgccgccaaagccaccacctcctccatagccaccgccgccgcgt gagaagccgccaccacccgaaggcctctcattggcgaagttcacacggac gttcctccctgcaagctcctgaccgtccatgccttttgcagcgctatctg catcagcttcattcgcaaagctcacaaaaccaaaccctctagaccttcca gtctctcgatcagtgatgacacgtgcctcaacgacctctccaaagctttg gaacgcctccttcagcgaatgatcgtcagtagcccaggccaggccgccga cgaaaagcttattgccaccagcgggctggccggcgcacatgaagcgggca gcgttgaacagggcaggagccgagccggtcgaggcactgctcgccaaagc actctgcctaagaaggcttccgagcttgatgagggccgccatggaggaag actaaaacctctggagggcgagctgggacgagacggcgtgggaagggggg aat
Download
page-top