Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570915
Length 778 bp
Fasta Format > rwhok10c11
tgtatatattatgcgtccgttcatatacatagccaccgatagcattctca tacgagcatgctttctcgagccatgttggtacatgaacatggacatacac atattcttaggaacaaataagaaagataaatggagaaggaaaacccaaag caatgtcagagttgacaaaactgcaatggcactttatatatggcctgtcg tgagtgagctgtttaggccttgccggactcctcgcagcccggtggcttga aggcgatgaagctgacgcactgcacctggcgcatgttgtcgaatccgatg atgcggacatacgcgtcagggtactccttcttgacctcctccacctcgtt gatcacctgtgtggcgtcggtgcacccgaacataggcagcttccacattg tccagtaccggccatcatagtacccaggggatgcgttgtgctcacggaag atgaacccaaccttgctgaactcgaggcaaggcacccacttggagcggat caggtagtcgacctgcttgaggagggcctccgtgctgagcggtggcaagt aggacagggtctcgaacttcttgatgccctcaatgggccacacctgcatg cacctgatccttccaccgttgctgacgctgccgaggctagcgccgttgga gcggcggctgacggggaggccggcggtggacttgagcccctggaaaggag cgacggaggtggccgacgaggccatcacggtgggggccatggctgtacta tgtangtatatancttgctangangang
Download
page-top