Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570912
Length 608 bp
Fasta Format > rwhok10c08
acagacacaattagataactcgaactagcctccacattatttgtttcgct ggagctggaaatgtaagctctacattcaggagcagcccatttcacagtcc atgttcatatctgaagggcatcagcgatagagctagcaaggctcaacacc tcaaatggagattgttggctgatggctttcaccgtctgagggcacgaatc cgtgatccagaagtaagcaaactggtcacctggcccagcagaattagcag tcatgaagcgttcatatgactgattggggaacacagcatgagttacatag gcgctaacttttgtagcaccatgagcagccagaactttctggcactctct aagagttccaccagattgcactaaatcatcaacaataacgacatgtcgcc cttcagggttcccttctttaatccggactatcctcttgtcgccttcacgg accttcgcacagacaaccaccgggaagttggccaacgacttgtggaagcg cttccacgccccatcatctgggaaggcaatggtgacattgtcggcgtcgg ggagctggctgaggcgctgcagcaggagtggtatgccggtctcgaagcag ggcaggac
Download
page-top