Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570907
Length 819 bp
Fasta Format > rwhok10c02
gcacgttacaaagcgagtctcgctcgttcacagtacaagttcaggaatac agcacgtacgtacacatttatcttatcttacggatcctggtgcccagcca gtgaatgcagccactgcaacaagcaaacaatcacacccaacaccacacgg ccgcagcacggtggagcaccgatcctctttatttatttcttaaccgaagc cgctctgctcccggatcatcgcgtcgcatggcgtcgctgctcggcgtcca gatcacttggtcgcgatgaacagcccccacttctgctcgccggcggagct ccgcttcagcttcgcgctccagccgttgacgatgtcgtcgtagtcctcct gggtgaagtccgccaggaaggcctccttgttcttctcggtctcgcccagc tccctctccaggaccctcaggaactggtcggtgcggtcttcggcgacgac atcgtggaaaccggcatcctcaagcatctttccataggtcttcacgtcat ggaggtcatagcctctctgcttgatgtatgcagcaaattcctctgacggt gtcccagggctcctgcagtagtcactgatcagcactttgcccccaggctt gagccacttgaagaagtttctgaacagagcgggtttgtcttgaatgtgga ggatggtgtcacggctgtagatcacatcaaacgtgttctctgcgtattcc ttggtggtgcagtcagcaacctcaaactcaaccgagcacgagcgcccgat ggcacgctcgatcgcgaacgaaaaccatgttgatggaaaanatcgatgcc gagggacatggacatcata
Download
page-top