Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570901
Length 903 bp
Fasta Format > rwhok10b13
tcttataggtttatttattgttcaagagataccctagacaaagaaaacag aaaagaaaggaggaaacaatctgtacagggtgccgaaaggaagctagaac aaaggtctcagtctcaggggatgatgatcacgcatgatcaatcagcactg ctctttctctaccgcctacaatgcaaaatgaagcgcaatgcaatgtccta caggaaatgctcatcatgctatctctactaccctcggccggagccgagtt ctcggggacgccctcgttcgtcgacgccgatcttcatggctggaacctcg ccgagggccccgagtcgccgctcacctcgaactcgctcgagctcgccttg gactcggcgtccgcgttgccaccaccggcatggccgcccctccggctcct ccggtcctcccgcgacgggacgtcctctgcctcgagcatccggacgacgt gacccatcgtgggtctcttctcggagtccgggtcgacacaccgcagcgcc actaggagggcgcgcttgagagcacggatggttggcttcacctccatgtc acggtccaccacctcgtcggctctctttgtgccgaccatcattttgagcc actccaccanatgcacctcattanctggccgaccatagtcaacaggatcc ctcccagtcactgcttccaggagcagcacgccaaaactgtacacatcact cttctcgtttaacanacctgtgttggcatactcgggggccacatacccna aagttcccataactcnantcntgatatggctcttccctgcacccancatc ttanccaatccaaaatcngaaagcttcccattgaaaatcctcatcaatta ngatattgcttgatttgatatcacngtgcacaacttttgggntctatggc ttc
Download
page-top