Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570897
Length 908 bp
Fasta Format > rwhok10b09
gagcactggtagtttacacttcacttatttcgcctgactgtattcacaag atatgacgctattcatgataaaactacacaaacgtccacaaattgacagc tcggaacagacgcatcaatcattccttgggcacttacgaggtgattgaaa aaggtcacaaatgaaatacgggcccacaagtcaccatggaaatacagtaa tgtcaaaggaatagctgacagttgtggcctcaggttctaacagcatcctg atgatccttgaccccggttgccacccaccacgtccacggtgtccggcata tacagttcttcctctggctcgttcttcagagcgttctttactatacactg gaaagcttcctccacgttgattccatccttggcagaagtctcaaagtatg ggatgttccctttagaggcacaccatgccttcgcctttttctcagaaacc acgcgactattcccgccatctacatcaactttgttacccagcagaacaaa agggaagttatcaggatctgatgggctagcctgaattagaaactcttcac gccagttgttcagattatcaaatgatttcattgagttaacatcgtaaact agaacacaacaatctgcaccgcggtagaatgcaacaccaagactttgaaa cctctcctgaccggcagtatcccatatttgtagggtgaagagcctgtcct cgaactgcacctccttggtgaggaaatcggcgccaatcgtagccttgtac tggttgctgaacttcttgttcacatattggttcatcaagggaagtcttcc caaccccgctgtcgccgaggatgatgaccttgaggagggtgcggcggcga gaggccatcgggatctagggtccggcgcgatcgatctcgctcgcgcgccc ggagggga
Download
page-top