Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570896
Length 661 bp
Fasta Format > rwhok10b08
acacatgntttaacaaccgatgcaatcatacgcaatccgcacatgtaaga ggttctacgagttcagaggatcatcgacaatccttgagtaattttttttc taccgcagttcagacatcagatataattactagcaaggaaggtttcacgt cagcatccagaacacccttggcctagtagccctgcttcatcctttcctcg aatcgggtcttctcatcctcaaaagcttgcttcaggttctcaagctcctt gtctagatcattgattgcctgggtatatgcctgagttggggaggattggc ttgcagtatggatcctaacaatgatcttgtactgaagggggtgagggagc ttatagccagcaaagtgaacatttgggtccctgtgcagctgcatgcggag gatgttcccgatggtgtggtcctcacgttcaatagtgaaagatgcagcat tcatgatctttgtatccttctcaaatgataccttcttcgtgccctcaggc acgacgaagcgctcatagcggtcaggggcattcatctccgatcaacactt ggctcctccttcctctgaaattactcgaggcgcacttcggcggcggcgtt ccgaggaagacgatgaagacctgcggcggtctgggtaaggttagagagta gtactagcggg
Download
page-top