Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570895
Length 295 bp
Fasta Format > rwhok10b07
aggtggntggtagttgataccacacttgaagccagtgnggcaccagtcaa caaactggatagtgcgcttggtcttgatggtggccncagcagcgttgaca tccttgggcacaacatcaccacggtacatgaggcaacaggccatgtactt gccgtggcgggggtcacacttggccatcatggangaatgctcaaaggcgc tgttggngatctcagcaacagacagctgctcatggtaggccttctcggct gagatcactggggcataagaaggaaagcatgaantggatcctcng
Download
page-top