Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570883
Length 611 bp
Fasta Format > rwhok10a15
atgccttacatactcaaattacaacactctacttgatcacctcctagatc tttaagccattgaaactagtaatccatagtacaaccacgaaaggggaaga taggcatatggagactacttgagatacgaagggcatttacaacttaatct cccgaagcaaaacttgggcttgctaatcacattggtacaaacataacctc acatatctgggtttcggcgtcagcacttctgatcggctgagcaagagcag tttccttggtcctgtttcagtttctcgatttggtcctgcagcactttgat gtagtcaacagcaatatccagcatgtcagaagtatttgtttgcttgtcca tgttgggcacgaggtcttgcagcctcctaagcctcttgctgatcctcgtt cttctttccctctcggcgatgctccgcgggtgagtggcgcagccgcgctt ggcgcggaccctgcaggcgacggagtcctgctgcagctgcaggtagtcgt ccatgccaggcatgtccagagacgagccaaactgggagtcgatgttgctg tagctggtgaccatgccgtcgtcgccgtcggccatcagcttggccttctt gccgccgccac
Download
page-top