Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570879
Length 915 bp
Fasta Format > rwhok10a11
tatagtagaattctggcattacaacatatagcggcaagaaaatactacag acaaatgatactaggtccactaggataatgggaaacacggggatacagtc gtctagacacgcggcagttgcatcagaccattttgtggctcaaaaagttt ctaatcgtcaccaaatgtggtcttcttccctgcgctagctgtgccagcac tctgtctgctctgaaagcctcggccgcctcctctgccgccatcacggcca ccagaccggccaaacctgccgccaccatcacggccaccagaccggccaaa cctgccgccgccatcacggccaccagaccggccaaacctgccaccaccag agcggccaccatctctgccaccagatcgaccaccaacgccaccaaattga cccttaggcttagcttcagcaacatacaagttgcagccacctaggtcaga tccactaagctcaagtgctttcgaaaaggaactctcatcagtaaaatcca tgtaagctatccctttgcttgcaccattctcataatccatcggaactgag acacgtgtgatttctccacatttagagaagtgttcttgaagagagctccg aatagcatcctcctgttgagatgaatcaaaacccttgacaaatactgaga ggctgggacctccacttggttttccaaacgatccaccatccctggtgcga ggagttgcacctctttcagcagccatgtcaagtctcaccggacggcccat tagatctccaccattcagtgaatcaagcgctttctgagcatcttcagccg tagcaaactcaacatgaccaaatcccttgggatggccatcttcatgggta gccaggcgaacatcaacgacctctccaatttgtgcaaaaaattgcttcac tngatcataactcaa
Download
page-top