Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ570869
Length 906 bp
Fasta Format > rwhok10a01
cccacaccaggcttccaatggtctagcaccatattttgtacagaaaaaga tattcaacatccttttctctgcatggtagttaccgcacgaccacatttca gccaaaatcggtacagtataatctactatcgcaaatttaggttggatcat cgcctcgaaaccggcaggccaacttgactcgcctatttcctaacatatat acagaaaaatattcagcactcattcgctgcgcaccgaattgtacttctcg gcaagtgaaggggtggccgttatcttgctcatcagattcttcaacttcat gctgtagtcgctgccacttatgcggtttacagcagcgattgctcgaagag cactgcgaatcaagtcttcgttgcgatcaatctcctgcttcactgcgtcg ctcttaggtttgtgaccgatggttttctcaagaggttcaactagcgagtc caaaactgcaagtacagcagaagggcacttgtctgctagcttcgagagaa tcagatggcagggcattttcacatcataatgatcacctaagccagataag aggaaaggaatgatgaaggacgacggattcacttgatcaagacagttatc cagcaatgtgtcaatacattcaaaggcagctttcctaagctcaagcccat catcaacgacatgcttgaaaggccctagatcaacggtcctgatcaattct tgcttcacgacagtctggtcatacaaaagaggcaacaattcaggaagaag acctttgatcaaacttggcttgttatgggcagctgtactcaacgcaagga cagctgcacgtcgcacatgcctgtcactatctttaattaacataagggaa agtagaaatctccgagtacaagattgcatctatctttcccagtccggttc aacgat
Download
page-top