Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ680664
Length 716 bp
Fasta Format > whok20f24
gctggtgatgttcgcatgaccgatacccgtgcagatgaggcagaacgtgg tattacaatcaaatccacgggtatctctcttttctatcagatgactcctg aatcacttgagatgtacaagggcgacagggatggtgatgagtacctgatc aaccttattgattcacctggccacgttgacttctcttcagaagtcacagc tgctcttcgtatcaccgatggtgctttggttgttgttgactgtattgagg gtgtctgtgtgcagactgaaactgtgctgcgccaagctcttggtgagagg attcggcctgtcctcaccgtgaacaagatggacagatgcttccttgagct tcaagtggaaggtgaggaagcatatcagactttctcccgtgtcattgaaa atgccaatgtcatcatggcaacatatgaagatgtgctccttggtgatgtc caagtgtacccagagaaggggactgttgcattctccgctggtttgcatgg gtgggctttcacccttacaaactttgctaagatgtatgcctccaagtttg gagttgatgaggcgaagatgatggagaggctttggggtgagaacttcttt gacccagccacaaagaaatggacctccaagaacactgggacagctacctg caagagaggtttcgttcagttctgctacgagccaatcaagcaaatcatag ccacctgcatgaaatg
Download
page-top