Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ680109
Length 798 bp
Fasta Format > whok19b12
ctaatccctacccccaccccacccgccgccatgtcgatccacgaccgccg gccgtcgcgtcccctgcctctgagcacaccaaatccaagaaaaagaagag caaatccaaggacgcctccgccgaccccgaccccgccgccgccgccgccg ataccacgtcgctggcggacgccgaggccaagactgatggctatatgatc aagccccaggccctggttccgtccctcgacacctccacctggccgctcct cctcaagaactacgaccgcctcaacgtccgcaccggccactacaccccgc tcccctccggccactcgccgctcaagcggcccctcgccgagtatctgcgg tacggcgtcatcaacctcgacaagccgtccaacccctcctcccacgaggt ggttgcctggatcaagcgcctcctccgcgtcgagaagaccggccacagcg gcacgctcgaccccaaggtcaccggcaacctcatcgtctgcgtcgaccgc gccacacgcctcgtcaagtcgcagcagggcgcaggtaaggagtatgtgtg catcgcccgcttccacgccgccgtcccagacacggcccgggtcgctcgcg cgctcgagtctcttaccggcgctgtgttccagcgcccgccgctcatctca gcggtcaagcgccagctcagggtgcggaccatttatgagagcaagctgct ggagcatgacgccgagcgccaccttgctgtgttctggatctcctgcgagg ctggaacctatgttccggacgctctgtgtgcaccttggggctgctcct
Download
page-top