Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ299670
Length 485 bp
Fasta Format > rwhsl31g21
tcgatcgagnatgcagcagctggctagtggcgacacggatatacatacga catacgtacgtataagggggcacacacacacacacacacattcaagtagg tacacagacgtatggctccatgggctagctagctgacgtacggngagggc cagctagccgtagcattccacatatgattttnnnctgcctgatgcacttg caccggcggaggggcccgtcgcagttgccgccgccccagcgttcctgcag gcagacctgcgcgcagttcttgtccgacacgcatggccccttgaaccccg cgctgcgctgccggcagatcttcgnctccgcccccggcaccgccgcctnc tgtgcgatgaggaggagaagcaggaccaaaaccacctgcgtcgccacctt cttggtccacatggtgagcggccgggctgggagcgagctaaactctgctt gcgctacgtactggctttgttactaccggtggagc
Download
page-top