Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ680087
Length 837 bp
Fasta Format > whok19a04
acggcggcgaagatggtgtcgctgaagctgcagaagcgcctggcctcgag cgtcctcaagtgcggcaagggcaaggtctggctcgaccccaatgaggtca acgagatctccatggccaactcccggcagaacatccggaagctggtaaag gatggtttcatcatcaggaagcctcagaagatccactccaggtctcgtgc aaggagggcacatgaggccaagcagaagggccgtcactctggatatggta agcgtaggggtaccagggaggctaggctccccaccaagatcctgtggatg cggaggatgcgcgtcctgaggcgccttctgcgcaagtaccgtgaggccaa gaagatcgacaagcacatgtaccatgacatgtacctgaaggtcaagggta acatgttcaagaacaagagggtcctcatggagagtatccacaagtccaag gctgagaaggcaagagagaagaccctctctgatcagtttgaggccaagcg cgccaagagcaaggcaagcagggagaggaagcatgccaggagggaggaga gattggctcagggccccagagatcatgcaccagcaccagcggctgcagct ccagctccagcagcagcggcaccaaagaaggccaaggccaagaagtgaag gtctgacatgaagctttagctttctggtatcatgaagggttancctgatt ttggagcatctgaagttcanaactgttttctgtgcaatatctgtgtgccg cgtatganataccttaaatatcatatcgtgtttgttctgttggatgttgc ttatgcanagtttctttaaacatttcngttcaccgaa
Download
page-top