Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ679745
Length 650 bp
Fasta Format > whok17l11
cagccctcttcaagcgcggcagactcctccccgcaaacccccagatcccg acgagaccacgccacagcgcggcgaagccctagcctccggccagcgccgc cgccgcagcgatggtgtacttcgactcatgggacgagttcgtcgaccggt ccgtgcagctcttccgcgccgaccccatcaccactcgctattgtatgaag taccggcactgcgacgggaagctcgtgctcaaggtcaccgacgaccgcga gtgcttgaagttcaagacggatcaagctcaggacgcaaagaagatggaga agctcaacaacatctttttcgctctcatgactcgtggacctgatgctgac ataagcgaggtttcagggaaggaacaagcggagcagcagcaatcaaagaa gggacggggcaggaggcagtagtatcatgctctggatttctttcagaaag atcacaactgggagtggtgggtggatattttgatcgactcctgttaagcc atgttacaactgtgagtggtgggtggtctaagagtggcgagtagttttca agacaatgtgcgagccatcgttggatccttttcctggcacanaaccgcga attacacttacccacacaatcatggttgatganacaaatcnnaaaaaaaa
Download
page-top