Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ679490
Length 802 bp
Fasta Format > whok16l21
ctttccacttagggttctagggtttctccagcagcgccggcgcctccacc cgcccacccaaccaccatgacggccgagaccgcgacgcaggcggagctgc tccgcgccgttctggaagagcagaagctcgctgcgcagggagacgagccc gtagttgaggatgatgatgatgaggaagatgaggatgatgatgacgagga tgacaaagatgatgatgttgagggagttgatgcaagtggaagatctaagc agagtaggagtgagaagaagagcaggaaggccatgctgaagcttggcatg aagactatcactggcgtgagccgtgtaactgtcaagaagagcaagaatat cctgtttgtcatctccaagccagatgtattcaagagccctgcctctgaca cctatgtcattttcggtgaggctaagattgaggatctgagctcacagctg cagtcccaggctgccgagcaattcaaagcgcctgatcttagcagcgtcat ctcaaaccctgaggcttctacagctgttcaggaggatgacgaggattgtg atgagactggagttgagcctaaggacattgaactggtgatgacccaggcc ggtgtgcctaggcccaaggctgtgaaggcgctcaaatctgctgacggtga catagtcagtgctatcatggaactgacgaactagccgggcccagcctgtg atattctgtcagtttttccttgtttacatgggaatacatgagttgtaacg tttggtggtcatgtgtgtgaactttgagctgctctgtattancaaagacc tg
Download
page-top