Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ679181
Length 640 bp
Fasta Format > whok15i09
aatctagcctctcaccatctccagctgagttcaacacgattactactgca aactcgatagggatggctcgcggtgcagctattccgctcgtgctggtcgc catggtggccactatgctcctcgtagccaccgacgcggccatctcctgcg gtcaggtgacctccgccttgagcccctgcatctcctatgcccgcggcaat ggcgccaacccgactgctgcctgctgcagcggtgtcaggagtctggccgg ggcagcccggagcaccgctgacaagcaagcggcgtgcaagtgcatcaaga gcgctgccggtgggctcaacgctggcaaggccgccggcatcccctccaag tgcggcgtcagcgtcccatatgcaatcagcgctaacgtcgactgctctaa gattcgctgatcaaccactgcccaccatggctgccgtccatagcgccatc catcaccgctgagtatgctgaggtctctaatacatatgaataaatgctct gatctgatctccatgtgagggagaaaggagtgcgtacgccgagctagctc tgcatggccggcaactattgtactactactatggttgtttttactttcac tacctttgaggagaaccgagactttattgtaaaaaaaaaa
Download
page-top