Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ678778
Length 864 bp
Fasta Format > whok13p04
tatcgcggcatcgggtcctgcgctgcgcgcctgctgctgctccctcgccc tcgcctccgctgccgtcgcgcgagatcaaccccgccgccatggctggaga agctgatgggaagacctaccaggtatcaaggatgccccctgctgctctca acgagcgcatcctttcttccatgtctcaaaagcacgttgctgctcaccca tggcatgacctggagataggtccaggggcccctgcagttttcaactgtgt ggttgagattcctagaggcagcaaggttaagtatgagttggacaaagcaa ctggtcttatcaaggttgatcgtgttctgtactcctcagttgtgtaccca cacaactatggcttcattccacgcacactctgtgaggataatgacccgat ggatgtccttgtcctgatgcaggaacaagttgttcctggttgcttcctgc gtgcccgtgctattgggcttatgcctatgattgatcagggtgagaaagat gacaagatcatagctgtctgtgctgatgatcctgagtaccgtcacttcag agacatcagtgaacttcccccgcatcgcctacaggaaatccgtcgcttct ttgaagactacaagaagaatgaaaacaaggaggttgcagtgaatgatttc ctcccancanaagatgccatcaacgcaatcaagtactcgatggacctcta cggttcgtacatcatggagggcttaaggaagtgatctccanttggtggac tgcggatgctacncgatccgccctacggcttatcaatantacnacagaca tctatgttaacatgatgatcnaaaaaccatcantctgttggggatctata tatacctttctgtc
Download
page-top