Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ678735
Length 707 bp
Fasta Format > whok13m04
tcgggtctgggaggatgacgacgggagggcgcgcggtgctcctactgccg cttctggtggcctcggcgctgttcgcgcagatccgcgcgtcggatccgct gttccacgagtccttcgacgagggcttcgaggggagctgggtcgtctccg gcaaggaagagtactcaggtgtatggaagcacgagaagagtgatggccat gaagactatggtctccttgtcagtgagccagccaggaaatatgccatagt caaagagcttgatagccctgttactttgaaggatgggacagttgtcctgc agttcgaagtgaggcttcagaatggcctcgagtgtggaggtgcttatctt aagtacattcgccctcaggaggctggatgggatgccaaggaatttgacaa tgacactccttacacaattatgtttggtcctgacaagtgtggttcaacga acaaggttcacttcatcctgaagcacaagaaccccaagactggcaaatat gttgaacatcacctcaagtccccaccctctgtcccatatgacaagctctc tcatgtctacacggctatcttgaagccggataacgaggtcagaattttgg ttgatggggaggagaagagcaaagcaaacttcctgtccgctgacnatttt gagccancacttattccatcaaagaccattcctgaccctgatgacaagaa nccanag
Download
page-top