Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ678678
Length 465 bp
Fasta Format > whok13i23
ggccgtggtggctctactggctacgacaacgccgtggcgctacccgccgg aggcagaggagacgaggaggagttggccaaggagaacgtgaagaacgcgt cctcctccacaggcaacatcacgctcagcgtgaccaagagcaagccggag accggcgaggtgatcggcgtcttcgagagcgtgcagccgtcagacaccga cctcggcgccaaggcgcccaaggatgtcaagatccagggtgtgtggtacg cgcagctcgagtctaactagagcagagcagaagtgaagatgctcatcttg tgtgcatgcgtacgtgggttgatcgttggagaggaaacaatcgaggcaac aatgtgtgtttgtgtgtgtatctagtaatctaaacccagggtgtcggttt atattttagcttctgttattgtttcttcctcgccaactcatgatattgac cctccaaaaaaaaaa
Download
page-top