Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ678552
Length 754 bp
Fasta Format > whok13b03
gcagctgccgggattatcgcccaggaagttgctggtgatgttcgcatgac tgatacccgtgcagatgaggcagaacgtggtattacaatcaaatccacgg gtatctctctgttctatcagatgactcctgaatcacttgagatgtacaag ggtgacagggatggggacgaatacctgatcaaccttattgactcacctgg tcatgttgacttctcttcggaagtgacagctgctcttcgtatcactgatg gtgctttggtggtggttgactgtattgagggtgtctgtgtgcagaccgaa actgtgctgcgccaagctcttggtgagaggattaggcctgtcctcaccgt gaacaagatggacagatgcttccttgagcttcaagtggaaggtgaggaag cataccagactttctcccgtgtcattgaaaatgccaatgtcatcatggca acatatgaagatgtgctccttggtgatgtccaagtgtacccggagaaagg gactgttgcattctctgctggtttgcatgggtgggctttcacccttacaa actttgctaagatgtatgcctccaagtttggagttgatgaggcgaagatg atggagaggctttggggtgagaatttctttgacccanccacaaagaaatg gacctccaagaacactgggacagctacttgcaagagaggtttcgttcant tctgctacnanccaatcnaancaaatcatcnccacctgcatgaatgatca naag
Download
page-top