Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682729
Length 784 bp
Fasta Format > whok9h12
tgttgcattctctgctggtttgcatgggtgggctttcacccttacaaact tcgctaagatgtatgcctccaagtttggagttgatgaggcgaagatgatg gagaggctttggggtgagaacttctttgacccagccacaaagaaatggac ctccaagaacactgggacagctacctgcaagagaggttttgttcagttct gctacgagccaatcaagcaaatcatcgccacctgcatgaatgatcagaag gataagttgtggcctatgttgaagaagctgggtgtgaccatgaagaatga tgagaaggacttgatgggcaaggctctcatgaagcgtgtgatgcaaactt ggctgcctgccagtcgtgctctgcttgagatgatgatatttcaccttccc tctccctcaaaggcacagaggtatcgtgtggagaacttgtacgagggtcc ccttgatgatatatatgctaatgctatcagaaactgtgaccctgatggtc ctcttatgctgtatgtctccaagatgattccagcatctgacaagggtagg ttctttgcctttggacgtgtttttgccgggagggttgcaactggtatgaa ggtccgtatcatgggtcccaactttgttcctggccagaagaaggatctgt atgtgaagagtgtccagcgtactgttatctggatgggaaagaagcaagag tctgttgaggatgttccctgtggtaacactgttgctttggttggtttgga tcanttcatcaccaanaatgcaacccctgacaaa
Download
page-top