Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682640
Length 661 bp
Fasta Format > whok9c10
agatctccgacaagttccacggtggggactcgtcgtcgtcgtcctcggac tcggacgacgagaagaaggggtcggcggcgggcgtcaaggccaagatcta ccgcctcttcggccgcgagaagcccgtccacgccgtcctcggcggcggca agcctgctgatcttgttctatggaggaacaagaaggtctccggaggggtg cttgctggcgctactgccatctggctgctgttcgaggtcatggagtacca tctgctcaccttggtgggccactgcctcatcctctccctggcaaccctct tcctctattccaatgtctgcattttcatccacaagtctcccccgaacatc cctgaggtgaaaatcccggaggacatgactgtaaacattgcactatcact gcggcatgagatcaaccggggcttctttaccttgagagagactggtcatg gtcgtgatctgaagaaattcctcattgtgattggagggctctggcttctt tctgttcttgggagctactgcaactttttgacactgtcatatatagtctt tgtggtgctgtacactgtgccagttctgtatgagaagtacgatgacaagg tggatgcttttggtgagaaggccatgatcgaattgaagaagtattatgcc atctttgaana
Download
page-top