Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682273
Length 758 bp
Fasta Format > whok7l02
agctcgggaggagagcgtggggggactagggagcatggcggagcacaagg aggagccggtggcggagtccatgatggacaagatctccgacaagttccac ggtggggactcgtcgtcgtcgtcctcggactcggacgacgagaagaaggg gtcggcggcgggcgtcaaggccaagatctaccgcctcttcggccgcgaga agcccgtccacgccgtcctcggcggcggcaagcctgctgatcttgttcta tggaggaacaagaaggtctccggaggggtgcttgctggcgctactgccat ctggctgctgttcgaggtcatggagtaccatctgctcaccttggtgggcc actgcctcatcctctccctggcaaccctcttcctctattccaatgtctgc attttcatccacaagtctcccccgaacatccctgaggtgaaaatcccgga ggacatgactgtaaacattgcactatcactgcggcatgagatcaaccggg gcttctttaccttgagagagactggtcatggtcgtgatctgaagaaattc ctcattgtgattggagggctctggcttctttctgttcttgggagctactg caactttttgacactgtcatatatagtctttgtggtgctgtacactgtgc canttctgtatganaantacnatgacaangtgggatgcttttggtganaa ngccatgatcnaattgaanaantattatgccatctttgaaananaaggtc ctgtcnaa
Download
page-top