Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682017
Length 808 bp
Fasta Format > whok6l20
ggaggaggagagcggcggcgaagatggtgtcgctgaagctgcagaagcgc ctggcctcgagcgtcctcaagtgcggcaagggcaaggtctggctcgaccc caatgaggtcaacgagatctccatggccaactcccggcagaacatccgga agctggtaaaggatggtttcatcatcaggaagcctcagaagatccactcc aggtctcgtgcaaggagggcacatgaggccaagcagaagggccgtcactc tggatatggtaagcgtaggggtaccagggaggctaggctccccaccaaga tcctgtggatgcggaggatgcgcgtcctgaggcgccttctgcgcaagtac cgtgaggccaagaagatcgacaagcacatgtaccatgacatgtacctgaa ggtcaagggtaacatgttcaagaacaagagggtcctcatggagagtatcc acaagtccaaggctgagaaggcaagagagaagaccctctctgatcagttt gaggccaagcgcgccaagagcaaggcaagcagggagaggaagcatgccag gagggaggagagattggctcagggccccagagatcatgcaccagcaccag cggctgcagctccagctccagcagcagcggcaccaaagaaggccaaggcc aagaagtgaaggtctgacatgaagctttagctttctggtatcatgaaggg ttagcctgattttggagcatctgaagttcanaactgttttctgtgcaata tctgtgtgccgcgtatganataccttaaatatcatatcgtgtttgttcaa aaaaaaaa
Download
page-top