Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ681991
Length 807 bp
Fasta Format > whok6k07
ctatccctgagaagaacatcagttgtttgacccgcctagaccacaacagg gcactcggtcagatttctgagagacttggtgtccaagtttctgacgttaa gaatgctattatctggggtaatcactcgtccagtcagtatcctgatgtta accatgccactgtgaagactcccagtggagagaagcctgttcgtgaactt gttcaagatgatgaatggctaaatggggagttcattgccactgtccagca gcgtggtgctgcaatcatcaaagcgaggaagctctccagtgctctctctg ctgccagctcagcttgtgatcacatccgtgactgggttctgggaaccgct gagggaacatttgtttccatgggtgtgtactctgatggttcatacggtgt gcctgctggtcttatctactccttcccagtaacgtgcagtggtggtgaat ggacaattgttcaagggctcccgatcgatgagttctcgaggaagaagatg gatgcgaccgcccaggagctgtcagaggagaaggcgttggcctactcatg cctggcgtaaatccacattcgaagggcagctgctcctctggatgttttga ataaatgaaaccttccgctctttanaaactctcgtctccacccanaacag ccgcacatcgcgatgcatgctccttttcgctggttttccaagtgtgtatg aatgaggcttgtanctccccttttgcctgatgatttacaggacagtacat ttgctgcaagagtgaaacaatttgacacctgattanaatcaacttgtttt tctcttg
Download
page-top