Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ681870
Length 790 bp
Fasta Format > whok6c19
gccacctcccgtttccacctctctatcctatggatagaaccgccgcgaca gccatagatatcctcgctatgatcccatcagcgccctctcctttgtagca ccatctcccctcccccancccacccccgggtttatttgataagatttgat cccaatcctcgcacgtttcttggccgagtgggggagaagattccagaaat ggccgtcgccgtagccgccgggaccctccgtacctgttccggcgtatttc cggcggcgtccgggaaccatccacttgccgggtggcggccacttgcaccg gcagcgcccgctaagctgagattattgtctccagctttgagggttcctag agctgcttcgcctgcagctgttgagaatgggagctctagcaacagtaata cagtccctacaccaaaagttataatagatcaagactcagatccggatgca actattgtggaagtaaccttgggtgaccgtcttggagatcttcttgatac tatgagtgccttgaggaatttagggctaaatgttgtgaaagctagtgtct gcctcgattcttctggcaagcacaataagttctctataacaaagtcgtca actggtcgcaaaattgatgacccagagttgttagaagcagtaagactgac aattattaacaacatgcttgagtatcatcctgaagctagcagtcaattgg ccatgggtgcaacttttgggctagagccccctacggaagtggttgatgtg gacatagcaactcacatagagatctatgacgatggtcctg
Download
page-top