Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ681323
Length 791 bp
Fasta Format > whok4a01
gtcgatccgttcccaagaagcagtggtatgacatcaaggcgccgctgctg ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtac caagattgcctcagagggtctgaagcacagggtgttcgaagtatctctag ctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgt gctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatgga cttcaccactgacaagctcaggtctcttgtgaggaagtggcagacactca ttgaggctcatgtggatgtgaagaccactgacaactacatgctccgcatg ttcaccattggcttcacgaagagacgcccaaaccaggtgaagcgcacttg ctatgcccaagcaagtcagatcagacagatccgccgcaagatggttgaga tcatggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaacaag ttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcat cttccccctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccc ccaagtttgacctggggaagctcatggaggtgcacggtgactacaaggag gatgttggtgtgaagcttgacaggcctgctgatggagatgangtgattcc tggancggaggaggttgctgctgctgagtanaaaatanaagtcgctattt tgctgcttcatatctagaanatgatatatgtgccacctggg
Download
page-top