Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ678337
Length 661 bp
Fasta Format > whok12e05
ctctccctatccccgctgtccagaatctaccccccggctccaatggcggc gaaggaaccgatgcgcgtgctcgtcaccggcgccgcaggacaaatcggat atgctcttgttcccatgattgccaggggagttatgcttggtgcagaccag cctgttattctgcatatgctggatattgaatttgctgctgaagctcttaa aggcgtcaagatggagttgatcgatgccgcatttccacttctcaagggag ttgttgcaacaactgatgttgttgaggcttgcactggtgtgaatgttgcg gttatggttggtggattccccaggaaggaaggaatggaaaggaaggatgt tatgacgaaaaatgtttcaatctacaaagctcaagcatctgctcttgaag ctcatgcagcccccaattgcaaggttttggttgttgccaacccancaaac accaatgctctcatcctgaaggagtttgctccatctatccctganaanaa catcagntgtttgacccgcctagaccacaacagggcactcggtcagattt ctgagagacttggtgtccaagtttctgacgttaagaatgctattatctgg ggtaatcactcgtccagtcagtatcctgatgttaaccatgccactgtgaa gactcccantg
Download
page-top