Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ678039
Length 703 bp
Fasta Format > whok11b23
gtcttgtgccacttgttggttccaacgatgagtcatggtgccaaggtctc gatggccttgcctcccgtgaagcagcatactaccagcaaggcgcccgctt cgccaagtggcgcactgttgtcagcattcctaatggcccatctgagcttg ctgtcaaggaagctgcctggggtcttgcccgttacgcggccatctcacag gacaatgggctggtgccgattgtggagcctgagatcatgctcgacggtga gcacggcatcgagaggaccttcgaggtcgcgcagaaggtgtgggcggaga ccttctactacatggcccagaacaacgtcatgtttgagggcatcctcctg aagccaagcatggtgacccctggtgccgagtgcaaggacagggccacccc cgaggaagtggccagctacaccctcaagctcctccagagaaggatccccc cttccgtccccggcatcatgttcttgtctggcggtcagtcggaggtggag gcgacgctgaacctgaacgcgatgaaccaggcgccgaacccgtggcacgt gtccttctcctacgcgcgggcgctccagaacacctgcctcaagacgtggg gtgggcggccggagaacgtggccgcggcgcangaggcgctgctgctgcgc gccaaggccaactccctggcgcanctcggcaagtacaccancgacggcga ggc
Download
page-top