Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ678001
Length 819 bp
Fasta Format > whok10p19
gcgcgcctgctgctgctccctcgccctcgcctccgctgccgtcgcgcgag atcaaccccgccgccatggctggagaagctgatgggaagacctaccaggt atcaaggatgccccctgctgctctcaacgagcgcatcctttcttccatgt ctcaaaagcacgttgctgctcacccatggcatgacctggagataggtcca ggggcccctgcagttttcaactgtgtggttgagattcctagaggcagcaa ggttaagtatgagttggacaaagcaactggtcttatcaaggttgatcgtg ttctgtactcctcagttgtgtacccacacaactatggcttcattccacgc acactctgtgaggataatgacccgatggatgtccttgtcctgatgcagga acaagttgttcctggttgcttcctgcgtgcccgtgctattgggcttatgc ctatgattgatcagggtgagaaagatgacaagatcatagctgtctgtgct gatgatcctgagtaccgtcacttcagagacatcagtgaacttcccccgca tcgcctacaggaaatccgtcgcttctttgaagactacaagaagaatgaaa acaaggaggttgcagtgaatgatttcctcccagcagaagatgccatcaac gcaatcaagtactcgatggacctctacggttcgtacatcatggagggctt aaggaagtgatctccagttggtggactgcggatgctacgcgatccgccct acggcttatcaatagtacgacagaacatctatgttaacatgatgatcgaa aaaccatcantctgttggg
Download
page-top