Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677846
Length 817 bp
Fasta Format > whok10g04
catttgtcagccttctgaatctacacttgatccagtgacatcagcattca caacattaaatatggctaggagcatgtcatatgcacagctaaaagcttat cacatggatgattaccaaagtcttttccagcgcgtgtccttgcaactttc acgaggctctaatggtgtacttggaggtagcactttggctcacttacctg agaatatctctcaggatgctgaggtatctgattgcactgtaccgatggtt gactgttcaaggttaaacgagcttaataattcagagaagcctactgtaga ccgaattataagttttagacatgatgaagatccttctctggtagaacttc tgtttcagtttgggcgctatctactcatttcttgttcgaggcctggaact caggtttccaatctgcaaggaatatggaacaacgagactaatgcaccatg gggtacagctccccatccaaatataaatcttcaaatgaattactggccat cacttccttgcaaccttagtgaatgccaagacccactattcgacttcatt ggatccctttcggtcaatggggctaagacggcaaaagtgaattacggagc taatggctgggtcagtcaccaagtcacagacttgtgggcaaaaacatcac cggatgctggtgatccttcatgggctctatggccaatgggtgggccatgg cttgctacacacctgtgggaacactacagttttacaatggacagagaatt tttggagagaacagcgtatccacttttggaaggatctgcctcctttctgt tgtcctggttgattgaa
Download
page-top