Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677842
Length 824 bp
Fasta Format > whok10f24
ccgatcccgaaccagggaggaacccggcgcgaggagggcaaaggaagaga agaggagatcaccgagcccagcgcgcgcacaggacagcaggcgccgcgat ctcgcgcaggagcggagatggggctcacgttcacgaagctgttcagccgg ctcttcgccaagaaggagatgaggatcctcatggtcggtctcgatgcggc tggtaagaccaccatcctctacaagctcaagctcggagagatcgtcacca ccatccccacaatcgggtttaatgtcgaaactgtagagtacaagaacatt agtttcaccgtttgggatgtcgggggtcaggacaagatcaggcccctgtg gaggcactacttccagaacacccagggtctcatttttgtcgtggacagca atgacagagagcgtgttgttgaggcaagagatgagcttcaccggatgctg aatgaggatgagctgcgtgatgctgtgctgctggtgtttgccaacaagca agatcttcctaatgccatgaacgctgctgaaatcactgacaagcttggcc tgcattctctgcgccagcgacactggtacatccagagcacatgtgctacc tctggagaggggttgtacgagggccttgactggctgtccaacaacattgc caacaaggcttgaagcatctcggcaggggcttctatggatctggataanc tggatattcngactaatactgcctttacntattataaactatatantctt gacanataaatgtgggtgttttggaaanataaagctctctgtcaaaganc tanctatcanattgttttcntggg
Download
page-top