Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ677841
Length 460 bp
Fasta Format > whok10f23
agaatttcagaagccaaggagagatcaaccaacaatgctgacacttcttg aattggggatctggatcctcccggtgacgcgcatcttcacgccatgcagg cgcctagttctcctacttgacaacctccagcagctgaaggagagcatcat gcgcacaaggtcgtcgtctccagccatttggagtcgcctggcgaggctgc agacgataaccgtcacattgtgaaggaaacccgggacttgatcctcagct ggagatgttcgaaacaccaatttcatcaggtgggcggcccttgctagcat ttccttgcctctggagtggggtgaataactcatcttgtccataaatagtc tgttttttagctttctcttgaaaccaaatgtattgtccctcgctgcatgt aagatggagataaacaaagaaagcaagtgacactactctcttgtgcattt aaaaaaaaaa
Download
page-top